Suggested problems

Custom Boxes UK

Oct. 19, 2021, 6:10 a.m. by markjackson

Biological Motivation

Free delivery is making the lives of the clients easier as the shipment is a worrisome task which demands energy and resources. We enable our clients to save their assets as flat or assembled boxes are delivered to the doorstep anywhere in the world. fastest turnaround services, get you your [custom boxes][1] in perfect form within 4-8 business days. Communication between both ends of the business is maintained via a customer representation group for a smoother experience. The networking team works day and night and is held accountable for satisfying each client. we provide a custom template for approval. An accessible website is serving the consumers for seeking online quotations and information about packaging while being at home.

[1]: https://gotoboxes.co.uk/custom-paper-cigarette-boxes/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21