Suggested problems

Buy Microsoft Office Professional Plus 2019 CD Key Global

Oct. 15, 2021, 2:20 p.m. by Buffcom net

Biological Motivation

Product Manufacturer: Microsoft Media Type: Key and Download. Can be used internationally. Can get the instructions via email account. Platform: Windows 10; Windows Server 2019 License Time: Lifetime Category: Microsoft Office https://buffcom.net/product/buy-microsoft-office-professional-plus-2019-cd-key-global/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21