Suggested problems

Need Help With Dissertation Writing Services UK

Oct. 14, 2021, 12:42 p.m. by Oliver jake

Biological Motivation

We Provide Dissertation Writing Services UK In The UK. Our team is highly inclined to help those students who face difficulties in completing Essay and Assignments due to any reason. We are serving students for many years with clear goals, high values, work excellence, and a supreme reputation. Encourage Students To Overcome Academic Work Processes By Providing Affordable essay Writing Services in the UK

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21