Suggested problems

Reach professionals to know How to send money on the cash app without debit card.

Oct. 14, 2021, 11:13 a.m. by Linda William

Biological Motivation

Sometimes, users want to know- [How to send money on a cash app without debit card][1]? If you are also having the same problem then feel free to ask your queries to the professionals. They are here to help you any time of the day. Get quick instructions directly from techies.

[1]: https://www.techjaadu.com/blog/get-money-off-cash-app-without-card/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21