Suggested problems

Professional Online Dating Services and Their Benefits If you have never tried using online dating services, then you have overlooked a very significant constituent part of the World Wide Web. Luckil

Oct. 11, 2021, 9:41 a.m. by Martha E. Clark

Biological Motivation

If you have never tried using online dating services, then you have overlooked a very significant constituent part of the World Wide Web. Luckily, it is never late to try. So, if you are an open-hearted person, who likes to communicate with people and looks for a perfect matchmaking experience, this article will teach you the basics of choosing the most reliable professional Internet dating services.

To start with, the choice of a trustworthy service is not simple. This is because there are plenty of them on the Internet and practically all of them have something interesting and intriguing to offer you. And, of course, there is hardly a website that may be called "the best one". The thing is that tastes differ and a website, which has appealed to one person, may not meet the demands and expectations of another user. That is why you should define what exactly you are expecting to get from the Internet dating website.

No matter how complicated the process of selection may seem at first sight, there are still a few points, which distinguish a truly professional online dating service from the indecent and unreliable one. First of all, it should be mentioned that a proficient online dating service is a company, which exists offline and has expanded to the Internet dating service. It usually offers its clients a rich database of people, who may potentially become their second halves.

Furthermore, professional services always function in real-time. This means that communication with clients is done via e-mail, telephones, and chatting. Any time you need to contact the provider of your online dating service, you simply use the available contact information to get access to them. It is extremely convenient since you do not have to wait until all your questions will be answered for a long time. However, you should keep in mind that you have to be more than eighteen years old to be able to register at such websites.

Another undeniable benefit of any professional online dating service is that it allows you to choose your perfect match among hundreds (if not thousands) of single people registered at that very Internet site. You just have to make up your own profile and submit it to the dating service you have selected. This will help you limit your search, since you may indicate your special requirements and criteria (place of residence, age, hobbies, etc.) concerning the choice of your potential partner.

Proficient Internet dating services provide their clients with lots of useful options. For example, you may not only communicate in chat rooms but also have an opportunity to see your conversation partner due to the option of video chatting. If it is not possible, you may inquire whether a voice greeting is available there or not. Though these aspects may not seem too significant, they still indicate that the service you have selected is a reliable one.

By the way, some users believe that professional online dating services always charge fees for the great options they offer. It is not always so. There are numerous free services, which are serious about their business. You just have to know where to search for them. Simply ask your friends, who have ever used them and had a successful experience, to recommend you something. Thus, you will be sure that you will not be misled by dishonest offers and promises.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21