Suggested problems

Running is Good

Oct. 10, 2021, 6:22 a.m. by jerrysmith0

Biological Motivation

Jogging or running is a popular form of physical activity. About one in five Australians try running (or jogging) at some stage in their life. Running is an appealing exercise because it doesn't cost a lot to take part and you can run at any time that suits you.

Some runners choose to participate in fun runs, athletics races or marathons. If you are interested in competing with other runners, contact your local running club.

Health benefits of running and jogging Regular running or jogging offers many health benefits. Running can:

help to build strong bones, as it is a weight bearing exercise strengthen muscles improve cardiovascular fitness burn plenty of kilojoules help maintain a healthy weight. Running versus jogging The difference between running and jogging is intensity. Running is faster, uses more kilojoules and demands more effort from the heart, lungs and muscles than jogging. Running requires a higher level of overall fitness than jogging.

Both running and jogging are forms of aerobic exercise. Aerobic means 'with oxygen' – the term 'aerobic exercise' means any physical activity that produces energy by combining oxygen with blood glucose or body fat.

Goal setting for running and jogging Think about what you want to achieve from running or jogging. Issues to consider may include:

Getting fit – if you're a beginner, you should start with brisk walking, progress to jogging and work up to running. This should take a few months. General fitness – mix your running with other forms of exercise (such as swimming or team sports) to maximise your overall fitness. Weight loss – adjust your diet to include plenty of fresh fruits and vegetables, lean meats, wholegrain cereals and low-fat dairy products. Cut back on dietary fats, takeaway foods, soft drinks and sugar. Companionship – you could run with a friend or join a local running club. Competition – running clubs may offer competitive events. Most clubs have sessions designed for beginners through to advanced runners. You can pit your running skills against others in fun runs or marathons. Many community-based running events cater for people of all ages and abilities. Join a local orienteering club to combine running with the challenge of navigating through various environments. [https://www.google.com/][1]

[1]: https://www.google.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21