Suggested problems

free astrology call centre 24 hours

Oct. 10, 2021, 3:48 a.m. by mk1694878

Biological Motivation

free astrology call centre 24 hours Astrologer Bajarang Lal Sharma is a well-known personality in the field of astrology. His interest in the astrology from his childhood has made him much popular today. There are lots of the people who have seen that how actually astrology works for them. This is all because of him.

[http://www.bestloveproblemsolution.info/astrologer-near-me-without-fees/][1] [http://www.bestloveproblemsolution.info/astrologer-without-fees/][2] [http://www.bestloveproblemsolution.info/bengali-astrologer-near-me/][3] [http://www.bestloveproblemsolution.info/best-astrologer-online-consu/][4] [http://www.bestloveproblemsolution.info/free-astrologer-online-solving/][5] [http://www.bestloveproblemsolution.info/free-astrology-call-centre-24/][6] [http://www.bestloveproblemsolution.info/free-astrology-consultation-on/][7] [http://www.bestloveproblemsolution.info/free-astrology-consultation-on-3/][8] [http://www.bestloveproblemsolution.info/free-astrology-consultation-on-2/][9] [http://www.bestloveproblemsolution.info/free-online-astrology-consultation/][10] [http://www.bestloveproblemsolution.info/free-online-astrology-consultat/][11] [http://www.bestloveproblemsolution.info/free-online-astrology-consult/][12] [http://www.bestloveproblemsolution.info/free-panditji-astrology-at/][13] [http://www.bestloveproblemsolution.info/lady-astrologer-near-me/][14] [http://www.bestloveproblemsolution.info/love-astrologer-near-me/][15]

[1]: http://www.bestloveproblemsolution.info/astrologer-near-me-without-fees/ [2]: http://www.bestloveproblemsolution.info/astrologer-without-fees/ [3]: http://www.bestloveproblemsolution.info/bengali-astrologer-near-me/ [4]: http://www.bestloveproblemsolution.info/best-astrologer-online-consu/ [5]: http://www.bestloveproblemsolution.info/free-astrologer-online-solving/ [6]: http://www.bestloveproblemsolution.info/free-astrology-call-centre-24/ [7]: http://www.bestloveproblemsolution.info/free-astrology-consultation-on/ [8]: http://www.bestloveproblemsolution.info/free-astrology-consultation-on-3/ [9]: http://www.bestloveproblemsolution.info/free-astrology-consultation-on-2/ [10]: http://www.bestloveproblemsolution.info/free-online-astrology-consultation/ [11]: http://www.bestloveproblemsolution.info/free-online-astrology-consultat/ [12]: http://www.bestloveproblemsolution.info/free-online-astrology-consult/ [13]: http://www.bestloveproblemsolution.info/free-panditji-astrology-at/ [14]: http://www.bestloveproblemsolution.info/lady-astrologer-near-me/ [15]: http://www.bestloveproblemsolution.info/love-astrologer-near-me/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21