Suggested problems

Call on the cash app helpline number to report a cash app dispute payment:

Oct. 8, 2021, 5:23 a.m. by james joy

Biological Motivation

The cash app is providing multiple services for the benefit of the users. It also gives us the feasibility to report and get a refund for a cash app dispute payment. Moreover, you can dial the helpline number to connect with our experts to know the complete and exact procedure to raise a dispute. https://www.cashappcustomersupport.com/blog/can-i-dispute-a-cash-app-payment/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21