Suggested problems

Top 9 cách đi backlink an toàn hiệu quả mà ai cũng muốn biết

Oct. 8, 2021, 4:14 a.m. by Đào tạo seo traffic

Biological Motivation

Trong một chiến dịch SEO website thì ngoài việc tác động trên site (Onpage) ra thì xây dựng những backlink chất lượng, có hiệu quả cũng là một trong những phần vô cùng quan trọng trong việc đem lại những giá trị góp phần tăng độ uy tín cũng như thứ hạng cho website.

Đã thành quy trình dù cho bạn tự SEO hay thuê dịch vụ làm SEO, sau khi ONPAGE bạn đều phải lên kế hoạch OFFPAGE mà cốt lõi là xây dựng chiến lược backlink. Khi mà các SEOer đều nắm khá vững các thủ thuật trong ONPAGE, các yếu tố trong OFFPAGE trở nên ngày càng quan trọng hơn khi SEO cho một website.

  1. Xây dựng link từ site có PR cao Trong các cách đặt backlink hiệu quả, đây hẳn là yếu tố đầu tiên mà mỗi SEOer quan tâm đến khi bắt đầu quá trình xây dựng backlink cho website. Theo kinh nghiệm của đào tạo seo traffic, các backlink nên đặt trong các diễn đàn có PR ≥ 4 để đạt được đánh giá tốt nhất từ Google. Dĩ nhiên điều đó không có nghĩa ta sẽ bỏ qua các diễn đàn có PR thấp. Nếu coi mỗi backlink là một phiếu bầu cho website của bạn thì “phiếu bầu” từ các website có uy tín (PR cao) sẽ có giá trị cao hơn. Tuy nhiên, nếu website của bạn chỉ nhận được phiếu bầu hoàn toàn từ các website có PR cao đó bạn sẽ bị Google để ý do tính bất thường. Do đó lời khuyên khi xây dựng backlink là nên phủ rộng link từ các diễn đàn có PR khác nhau và tập trung nhiều vào các diễn đàn có thứ hạng cao.

  2. Đặt backlink trong nội dung bài viết

Có nhiều vị trí cho bạn đặt anchor text: chữ ký, bài viết,…Tuy nhiên khuyến cáo là nên có backlink trong phần nội dung của bài viết. Link trong chữ ký, trong phần comment sẽ không được đánh giá cao. Và cách đặt backlink hiệu quả ở đây là mỗi một liên kết mà ta muốn trỏ tới chỉ xuất hiện một lần trong bài đó.

  1. Đặt backlink ở các web có traffic cao

Điều này cũng dễ hiểu, vì các web có traffic cao vốn dĩ đã được Google đánh giá cao cho nên bài viết chưa liên kết của bạn cũng được đánh giá cao hơn. Ngoài ra, với lượng traffic lớn, nếu bài viết của bạn tốt cũng tăng khả năng người đọc xem bài của bạn và click vào văn bản neo trên đó.

Xem thêm tại: https://daotaoseotraffic.com/top9-cach-di-backlink-an-toan/

Khóa học Digital Marketing:

Khóa học Digital Marketing thực chiến hướng dẫn người học cách lập kế hoạch Digital Marketing bài bản. Phương pháp giảng dạy đơn giản hóa các kiến thức, giúp học viên dễ tiếp thu và nhớ lâu. Với Đào tạo seo Traffic học Digital Marketing trở nên dễ dàng hơn rất nhiều.

Bạn tham khảo khóa học tại:

Liên hệ đào tạo seo tại: https://daotaoseotraffic.com/

Địa chỉ: Số 13 Cộng Hòa, Phường 4, Tân Bình, Thành phố Hồ Chí Minh, Việt Nam

Hotline: 0933523333

Gmail: admin@daotaoseotraffic.com

daotaoseo #daotaoseotraffic #khoahocseowebsite

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21