Suggested problems

Want to contact the cash app help to activate the cash app card?

Oct. 7, 2021, 11:17 a.m. by miler david

Biological Motivation

Want to contact the cash app help to activate a cash app card if you want then you have chosen the right path to activate your card. On this path, you will know how to activate a cash app card for this you just have to click on the [cash.app/help][1] link.

[1]: https://www.cash-app-helps.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21