Suggested problems

Godrej Park Retreat | A Housing Retreat | Sarjapur Main Road | East Bangalore.

Oct. 7, 2021, 11:13 a.m. by Godrej Park Retreat

Biological Motivation

[Godrej Park Retreat][1] a Housing get back look for in case you're looking for a standout, incomparable and keen metropolitan way of life. This freshest conceptualisation of Godrej Properties is emerging in first class areas off Sarjapur interstate , East Bangalore. The municipality is preparing for pre-dispatch soon with every significant endorsement, NOCs and RERA enlistments. Godrej Properties, an auxiliary of [Godrej Groups][2] might be an archived name in Indian land area. The firm is engaged with multitudinal business portfolios that remember land advancement for both private and business fronts.The firm is denoted a 'Public Brand Leader' according to the Track2realityBrandxreport for the year 2020 – 2021. they're likewise India's driving area engineer as far as deals reserving for FY 2021. [Godrej Properties][3] brings the Godrej Group reasoning of advancement and greatness to the significant home industry. the corporate is at present creating milestone projects in 12 urban communities across India. Set up in 1990, Godrej Properties Limited is that the main land organization to have ISO accreditation. With projects that range the nation over, the organization's impending advancement covers more than 8 million square meters. to make milestone structures, Godrej Properties teams up with remarkable partners and rumored names. the corporate expects to convey better worth than all or any partners through phenomenal and innovative spaces made out of profound client concentration and knowledge.

[1]: https://www.godrejsparkretreat.in/ [2]: https://www.trepup.com/godrejpark-retreat-059100/stories/635202 [3]: https://bandcamp.com/godrejparkretreat01

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21