Suggested problems

Thắc mắc An Trĩ Nam có hiệu quả như lời đồn?

Oct. 6, 2021, 1:18 p.m. by pkdknguyentrai

Biological Motivation

Trĩ là một trong những căn bệnh gây đau đầu nhất hiện nay nó không những ảnh hưởng đến sức khỏe mà còn cả tâm lý của bệnh nhân. Vậy làm cách nào để thoát khỏi căn bệnh khó chịu này? Cùng tìm hiểu An trĩ nam loại thuốc tiêu trĩ hiệu quả nhất hiện nay nhé!

An Trĩ Nam là gì? Thuốc [An Trĩ Nam][1] là cao tiêu trĩ là một loại thuốc nam gia truyền dành cho những người bệnh trĩ của nhà thuốc An Dược và Tâm Minh Đường. Tác dụng chính của thuốc là làm giảm các triệu chứng như: chảy máu, đau rát, nứt kẽ hậu môn, thường xuyên táo bón ở những người bị trĩ,...Hơn nữa nó còn giúp cho tĩnh mạch bền chặt và tăng tính đàn hồi, chống táo bón.

Giới thiệu thành phần của An Trĩ Nam Dạng viên uống: Bao gồm cam thảo, hoa hòe, ý dĩ, bồ công anh, đào nhân, mộc hương,… Đa số các thảo dược này giúp làm chặt thành mạch, thanh lọc cơ thể, đại tiện dễ dàng.

Dạng thuốc ngâm: Cũng tương tự như dạng viên bao gồm các thảo dược thiên nhiên như: hòe hoa, mã dâu linh, ngũ bội tử, ngư tinh thảo, nha đảm tử, toàn yết, tỳ giải, bạch thược, hoàng liên,…Công dụng chính là sát trùng, tiêu viêm, làm bền chặt các thành mạch, hạn chế sa giãn.

An Trĩ Nam

Tác dụng chính An Trĩ Nam giúp người bệnh chống lại trĩ như:

Giúp làm vững thành mạch, hạn chế sa giãn, rò hậu môn

Giảm đau không gây thương tổn đến các dây thần kinh hậu môn

Sau khi thắt trĩ sẽ giúp chống viêm đau, chảy máu, vết thương nhanh liền và hỗ trợ phục hồi bệnh nhanh chóng.

Giá tiền của An Trĩ Nam là bao nhiêu? Theo mặt bằng chung của thị trường thì thuốc An Trĩ Nam có giá 1.100.000 VNĐ. Trong đó bao gồm cả thuốc uống và thuốc ngâm. Tuy nhiên giá thuốc có thể thay đổi ở từng thời điểm nhưng sự chênh lệch không đáng kể.

Một lời khuyên cho các bạn nên khám và uống thuốc An Trĩ Nam theo liều lượng của bác sĩ tránh trường hợp tác dụng phụ hoặc sốc thuốc không đáng có. Hiện nay thuốc đã có mặt tại các nhà thuốc tiện cho mọi người mua.

Cách sử dụng thuốc An Trĩ Nam Đọc kỹ hướng dẫn sử dụng được in trên bao bì, cụ thể:

Hòa tan một thìa bột cao tiêu trĩ An trong nước ấm, nóng đối với thuốc dạng uống

Đặc biệt đối với bệnh nhân bị trĩ từ cấp độ 2 trở lên nên sử dụng cả 2 dạng uống và ngâm hậu môn để tăng cao hiệu quả

Hòa tan một lượng bột vừa đủ với nước ấm, rồi ngâm hậu môn đến khi nước nguội hẳn, rồi lau lại bằng khăn mềm đối với dạng ngâm.

Phải vệ sinh sạch sẽ hậu môn trước và sau khi ngâm.

An Trĩ Nam hiệu quả như thế nào?

Cần lưu ý gì khi sử dụng An Trĩ Nam? Khi sử dụng thuốc nên kiêng cử một số điều như sau:

Giảm thiểu thực phẩm quá mặn vì chúng có xu hướng giữ nước, khiến cho các tế bào mạch máu căng, giãn ra.

Trong thời gian trị tuyệt đối không sử dụng thực phẩm có tính cay, nóng như rượu, cà phê, thực phẩm có chứa cafein. Các loại thực phẩm này gây khó chịu cho dạ dày, nhất là khi đào thải phân qua hậu môn.

Hạn chế uống nước ngọt có ga cũng nên hạn chế khi mắc bệnh trĩ, vì chúng có thể gây áp lực cho khung ruột.

Không sử dụng các thực phẩm làm bón gây ức chế các dây thần kinh hậu môn

Ít sử dụng thực phẩm nhiều dầu mỡ

Ngoài ra nếu các bạn muốn an tâm chữa trĩ có thể đến ngay Phòng khám Đa khoa Nguyễn Trãi một địa chỉ chữa trĩ được nhiều bệnh nhân phản hồi tích cực.

An Trĩ Nam công dụng chính

Phòng khám đa khoa Nguyễn Trãi Địa chỉ: 80 - 82 Châu Văn Liêm P.11,Q.5, TPHCM

Hotline: 028 3923 9999

Chuyên khám và điều trị các bệnh xã hội. Với phương châm “Sức khỏe của bạn là trách nhiệm của chúng tôi” tự hào đem đến chất lượng cho từng khách hàng tin tưởng vào dịch vụ khám chữa tại đây.

Cảm ơn các bạn đã đọc bài viết về thuốc An Trĩ Nam mà [Phòng khám Đa khoa Nguyễn Trãi][2] đã chia sẻ. Nếu cảm thấy hay và bổ ích hãy chia sẻ nhé! Chúc mọi người mau khỏi bệnh!

[1]: https://phongkhamdakhoanguyentrai.com/an-tri-nam-thuoc-tri-tri-bao-dam-hieu-qua.html [2]: http://phongkhamdakhoanguyentrai.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21