Suggested problems

free astrology call centre 24 hours

Oct. 5, 2021, 4:03 a.m. by mk1694878

Biological Motivation

free astrology call centre 24 hours Molana is a famous Islamic astrologer who is famous for his services. He has good knowledge of Islamic astrology as there are many people who are still not aware of it. But this spiritual astrology helps a person to end the troubles of his life. Molana ji has had an interest in it from a very young age. He has knowledge about Quran which he uses to serve the people by providing the right solutions.

[https://www.muslimsupport.info/free-astrologer-online-solving-problems/][1] [https://www.muslimsupport.info/free-astrology-call-centre-24-hours/][2] [https://www.muslimsupport.info/free-astrology-consultation-on-phone-in-telugu/][3] [https://www.muslimsupport.info/free-astrology-consultation-on-whatsapp/][4] [https://www.muslimsupport.info/free-muslim-astrology-at-whatsapp/][5] [https://www.muslimsupport.info/free-vashikaran-without-money/][6] [https://www.muslimsupport.info/love-problem-solution-without-money/][7] [https://www.muslimsupport.info/love-marriage-specialist/][8]

[1]: https://www.muslimsupport.info/free-astrologer-online-solving-problems/ [2]: https://www.muslimsupport.info/free-astrology-call-centre-24-hours/ [3]: https://www.muslimsupport.info/free-astrology-consultation-on-phone-in-telugu/ [4]: https://www.muslimsupport.info/free-astrology-consultation-on-whatsapp/ [5]: https://www.muslimsupport.info/free-muslim-astrology-at-whatsapp/ [6]: https://www.muslimsupport.info/free-vashikaran-without-money/ [7]: https://www.muslimsupport.info/love-problem-solution-without-money/ [8]: https://www.muslimsupport.info/love-marriage-specialist/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21