Suggested problems

How to Get Low Cost Linux Dedicated Server

Oct. 4, 2021, 6:50 a.m. by Hostnet india

Biological Motivation

Hostnetindia is the best platform if you are willing to Purchase [Low-cost Linux Dedicated Server][1]. You will get Processor Xeon Single Quad-core E3-1230 v3, 16 GB DDR3, 1 TB SATA and much more, and all this at very reasonable prices. So, grab the server now. You get 24*7 supports for any query at all the time from the best and professional members in the technical team to solve their problems. So, grab the server of your choice now Linux Dedicated Server.

[1]: https://hostnetindia.com/linux-dedicated-server

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21