Suggested problems

+91-7357935089 Love Problem Solution in Canada

Oct. 3, 2021, 6:11 a.m. by mk1694878

A Rapid Introduction to Molecular Biology

Love Problem Solution in Canada love Marriage Specialists +91-7357935089 relationship and love marriage issues solving is the speciality of his years of experience has helped him device powerful mantras, that can compel the mind of lover to fall back in love or convince parents to agree for marriage.

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21