Suggested problems

Microsoft365.com/setup

Sept. 29, 2021, 7:21 a.m. by Neil Nolan

Biological Motivation

Use your Microsoft account through [microsoft365.com/setup][1] for everything you want to with Microsoft 365. Create an account or use the account of services such as OneDrive, Skype, Outlook, or Xbox Live. Use the site [microsoft365.com/setup][2] to download and install Microsoft 365 setup that will allow you to use multiple apps like Word, Excel, OneNote, PowerPoint, or more.

[1]: https://msoft365setup.com/ [2]: https://soft-365setup.com/ ...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21