Suggested problems

Biological Motivation

Six different reading frames (2 directions x 3 offsets) can generate six different translated peptides from a single strand of DNA** . Being able to reproduce from a 5'3' strand of DNA, the 3'5' strand, the corresponding transcribed RNAs and the six translated pepetides (amino acid sequences) shows that the student has a basic understanding of the transcription and translation process. (Reading, transcribing and translating the 3' 5' right to left direction is particularly important). This exercise also demonstrates the overlapping nature of the DNA code.

Successful completion also shows an understanding of the conventions for representing amino acids.

Source: Figure 4.3 page 187 (second edition) of BIOINFORMATICS ALGORITHMS An Active Learning Approach...

Problem

A strand of DNA contains nucleotides, that when properly transcribed to RNA allows translation to proteins illustrating the classic role of DNA in providing information for the proper sequencing of peptides.

DNA -----> RNA ------> Peptide.

Given: A DNA string $s$ of length at most 1000 nucleotides. (the 5'3' strand).

Two dictionary files which translate RNA codons to the single letter convention for amino acids and the three letter convention for amino acids or one dictionary file that translates RNA codons directly to the three letter convention for amino acids.

Return: The program should output the following:

1. The labeled 3'5' strand of DNA (from the original input)
2. The transcribed RNA strands from the 5'3' DNA and 3'5' DNA strands
3. The three translated peptides from the 5'3' strand, one peptide for each offset (reading frame). Optionally the peptides should be aligned to reflect the offset The peptides should use the three letter convention for amino acids.

Sample Dataset

GTGAAACTTTTTCCTTGGTTTAATCAATAT

Sample Output

**DNA 5'3': GTGAAACTTTTTCCTTGGTTTAATCAATAT
RNA 5'3': GUGAAACUUUUUCCUUGGUUUAAUCAAUAU
offset:  2  peptide:  GluThrPheSerLeuValSTPSerIle
offset:  1  peptide:  STPAsnPhePheLeuGlyLeuIleAsn
offset:  0  peptide:  ValLysLeuPheProTrpPheAsnGlnTyr
DNA 3'5': CACTTTGAAAAAGGAACCAAATTAGTTATA
RNA 3'5': CACUUUGAAAAAGGAACCAAAUUAGUUAUA
offset:  0  peptide:  HisPheLysLysArgProLysIleLeuIle
offset:  -1  peptide:  PheSerLysGlyGlnAsnLeuSTPTyr
offset:  -2  peptide:  SerValLysGluLysThrSTPAspIle**
>>>