March 9, 2023, 7:44 a.m. by KHOEPLUS24h Sức khỏe thể thao dinh dưỡng bí quyết sống khỏe
Biological Motivation
Từ lâu, quả sơn tra đã được biết với nhiều tác dụng tuyệt vời cho sức khoẻ của con người. Vậy quả sơn tra có tác dụng gì? Mua ở đâu? Cùng KHOEPLUS24H tìm hiểu về loại quả mọng này qua bài viết dưới đây nhé! NGuồn (Source): https://www.khoeplus24h.vn/qua-son-tra-la-qua-gi-tac-dung-cua-son-tra-cach-dung-va-noi-mua-1113/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
