March 8, 2023, 2:33 a.m. by MIUI.vn - Chuyên trang công nghệ
Biological Motivation
Tai nghe Mozard của nước nào mà tốt đến như vậy? Đây chắc hẳn là câu hỏi của nhiều người sau khi sử dụng các thiết bị điện tử của hãng. Cùng miui tìm câu trả lời thông qua bài viết dưới đây nhé! Nguồn (Source): https://miui.vn/cong-nghe-khoa-hoc/dien-tu-vien-thong/mozard-cua-nuoc-nao
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
