March 7, 2023, 2:53 p.m. by MISSKICK - Kiến thức thời trang, mỹ phẩm, trang điểm, khỏe đẹp.
Biological Motivation
Nhựa PVC được ứng dụng rất nhiều trong đời sống, đây là nguyên liệu chính để chế tạo ra các vật dụng mà chúng ta vẫn sử dụng hàng ngày. Vậy nhựa PVC là loại nhựa như thế nào? Hãy cùng tìm hiểu ngay trong bài viết này nhé! NGuồn (Source): https://misskick.vn/nhua-pvc-la-gi-tinh-chat-va-ung-dung-pho-bien-cua-nhua-pvc
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21