Suggested problems

Nhua PVC la gi Tinh chat va ung dung pho bien cua nhua PVC

March 7, 2023, 2:53 p.m. by MISSKICK - Kiến thức thời trang, mỹ phẩm, trang điểm, khỏe đẹp.

Biological Motivation

Nhựa PVC được ứng dụng rất nhiều trong đời sống, đây là nguyên liệu chính để chế tạo ra các vật dụng mà chúng ta vẫn sử dụng hàng ngày. Vậy nhựa PVC là loại nhựa như thế nào? Hãy cùng tìm hiểu ngay trong bài viết này nhé! NGuồn (Source): https://misskick.vn/nhua-pvc-la-gi-tinh-chat-va-ung-dung-pho-bien-cua-nhua-pvc

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21