March 7, 2023, 4:10 a.m. by andrewmoon
Biological Motivation
In the video game [Drift Hunters][1], players search for the finest courses to create using vintage vehicles like the Toyota AE86 Thunder, Pontiac Trans Am, and 2016 Fiesta. Why not play Drift Hunters and tell us what you think? ...
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
