March 6, 2023, 12:37 p.m. by KHOEPLUS24h Sức khỏe thể thao dinh dưỡng bí quyết sống khỏe
Biological Motivation
Bạn đã từng chọn khoai tây tím để chế biến món ăn hay chưa, nó có giống khoai lang tím và khoai mỡ mà bạn hay sử dụng không? Vậy hãy cùng chuyên mục Sức khoẻ dinh dưỡng tìm hiểu nhiều hơn về khoai tây tím là gì, mua ở đâu? 7 tác dụng bất ngờ của khoai tây tím ra sao nhé! NGuồn (Source): https://www.khoeplus24h.vn/khoai-tay-tim-la-gi-mua-o-dau-7-tac-dung-bat-ngo-cua-khoai-tay-tim-1067/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
