Suggested problems

Biological Motivation

Cydia là gì hay Cydia được cài đặt, sử dụng như thế nào là thắc mắc của rất nhiều người dùng iPhone hiện nay. Vậy cụ thể Cydia là gì? Cydia demo là gì? Jailbreak là gì? Cách đăng nhập, cài đặt và sử dụng Cydia như nào?… Trong bài viết chi tiết dưới đây, DINHNGHIA.Com.Vn sẽ chia sẻ với bạn những kiến thức tổng hợp về Cydia, cùng tìm hiểu nhé! Nguồn (Source): https://www.dinhnghia.com.vn/cydia-la-gi-cach-dang-nhap-cai-dat-va-su-dung-cydia/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21