Suggested problems

Biological Motivation

Klonopin (Clonazepam) is a potent anticonvulsant oral prescription medication used to treat certain seizure disorders in adults and children; for the intense absence of seizures or Lennox-Gastaut syndrome). If you are dealing with similar symptoms, you can Buy Klonopin Online to cure them effectively. It belongs to the benzodiazepine group of medications that acts by enhancing the activity and functions of specific chemical messengers, neurotransmitters, and GABA levels in the brain. These balanced GABA levels in the brain calm the brain and nerve cells and produce relaxing effects to reduce hyperactivity and anxiety symptoms. Klonopin starts its effects within 1 hour, and its active duration is 6 to 12 hours.

https://uswebmedicals.com/product/klonopin-2mg/

https://www.bark.com/en/us/company/buy-klonopin-online--klonopin-2mg--overnight-delivery--us-web-medicals/BP2Az/

https://www.bark.com/en/us/company/buy-klonopin-online--klonopin-2mg--next-day-delivery--us-web-medicals/qVYeM/

https://www.bark.com/en/us/company/order-klonopin-online--clonazepam-for-sale--klonopin-for-sale--next-day-delivery/8kQq1/

https://www.bark.com/en/us/company/buy-klonopin-online--clonazepam-for-sale--klonopin-for-sale--klonopin-online---klonopin-next-day-delivery/ny8gl/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21