Suggested problems

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

Greetings, I want to tell you about one great service where you can transfer your money abroad very quickly and qualitatively, I also advise Profee send money you to try it, because it is the best of the best.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21