March 4, 2023, 2:14 a.m. by MIUI.vn - Chuyên trang công nghệ
Biological Motivation
Đồng hồ thông minh đang dần thay thế đồng hồ truyền thống nhờ những tính năng tiện lợi vượt trội. Hãy cùng MIUI.VN tìm hiểu TOP 8 đồng hồ thông minh nghe gọi chống nước thông qua bài viết dưới đây nhé! Nguồn (SOurce): https://miui.vn/cong-nghe-khoa-hoc/dien-tu-vien-thong/dong-ho-thong-minh-nghe-goi-chong-nuoc
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
