March 3, 2023, 8:08 a.m. by aishwarya953
Biological Motivation
I did graduation from non It field But now I want to Switch my career Into IT that means In [Full stack developent course][1] or [Java Course][2] suggest me from where i have to start.
...
[1]: http://%20https://www.clariwell.in/full-stack-development-courses-in-pune [2]: https://www.clariwell.in/best-java-course-in-pune
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21