Suggested problems

Biological Motivation

Máy chạy bộ là thiết bị không còn xa lạ đối với những bạn yêu thích luyện tập thể thao. Trên thị trường hiện nay có 2 loại máy là máy chạy bộ cơ và máy chạy bộ điện đang được nhiều người quan tâm. Vậy nên mua máy chạy bộ cơ hay điện? Cùng giải đáp thắc mắc qua bài viết bên dưới nhé! Nguồn (SOurce): https://miui.vn/suc-khoe-doi-song/nen-mua-may-chay-bo-co-hay-dien

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21