Feb. 28, 2023, 4:22 p.m. by DINHNGHIA.com.vn - Bách Khoa Toàn Thư
Biological Motivation
Rất nhiều người đã quen thuộc với bộ môn jogging, nhưng để các bạn hiểu rõ hơn nữa khái niệm của bộ môn này thì Dinhnghia sẽ giúp bạn tìm hiểu Jogging là gì và làm sao để phân biệt running và jogging. Nguồn (Source): https://www.dinhnghia.com.vn/jogging-la-gi/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21