Suggested problems

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

I recently took a pedicab tour of San Diego's historic Gaslamp Quarter, and it was an unforgettable experience. Our driver was passionate about the city's history and architecture, and he took us to some amazing spots https://urbanpedicabs.com/san-diego-pedicab-tours-urban-pedicabs/ that we wouldn't have found on our own. I would highly recommend this tour to anyone interested in San Diego's rich history.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21