Feb. 27, 2023, 3:32 p.m. by MIUI.vn - Chuyên trang công nghệ
Biological Motivation
iPhone 14 quả là một cú bùng nổ lớn Apple dành cho người hâm mộ vào năm 2022. Bài viết hôm nay giới thiệu đến các IFan những ốp lưng iPhone 14 chính hãng mà bạn có thể tham khảo trang bị cho chiếc điện thoại hot nhất thời điểm hiện tại. Nguồn (SOurce): https://miui.vn/cong-nghe-khoa-hoc/dien-tu-vien-thong/op-lung-iphone-14-series
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
