Suggested problems

Biological Motivation

Nhiều người cảm thấy uể oải và không đủ tinh thần để tiếp tục công việc sau khi trải qua một kỳ nghĩ Tết dài. Cùng VANHOADOISONG tìm hiểu một vài “mẹo” giúp bạn có thể nhanh chóng bắt kịp nhịp cho công việc sau Tết một cách hiệu quả nhé! Nguồn (Source): https://vanhoadoisong.vn/bo-tui-nhung-meo-nho-giup-ban-bat-kip-nhip-cong-viec-sau-tet-hieu-qua-1089/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21