Feb. 26, 2023, 8:53 a.m. by MISSKICK - Kiến thức thời trang, mỹ phẩm, trang điểm, khỏe đẹp.
Biological Motivation
Gọng kính bị mốc xanh là vấn đề mà rất nhiều người gặp phải sau khi sử dụng mắt kính được một thời gian dài. Vậy làm như thế nào để khắc phục triệt các vết mốc này? Cùng tham khảo ngay các mẹo xử lý gọng kính bị mốc xanh cực hữu ích trong bài viết dưới đây nhé! Nguồn (Source): https://misskick.vn/6-meo-xu-ly-gong-kinh-bi-moc-xanh-cuc-hieu-qua-nhanh-chong
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21