Feb. 26, 2023, 6:01 a.m. by DINHNGHIA.com.vn - Bách Khoa Toàn Thư
Biological Motivation
Công nghệ Aeroready adidas được ứng dụng trong các loại áo thể thao, quần thể thao của hãng Adidas với những cải tiến về chất liệu vải. Hãy cùng tìm hiểu công nghệ Aeroready adidas là gì trong bài viết dưới đây nhé! Nguồn (Source): https://www.dinhnghia.com.vn/cong-nghe-aeroready-adidas-la-gi-cong-dung-cua/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21