Suggested problems

Biological Motivation

...

Problem

For more complex projects, we can offer services for complex algorithm development, machine learning, and scientific analysis. In addition, our team https://www.voypost.com/hire-flask-developers offers services for the development and implementation of cloud computing systems, automation and modeling, building high-load architectures, and remote operation.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21