Suggested problems

Biological Motivation

Hello people! I genuinely need to direct you an exceptional application for Android and iOS in which you can bet, this connection enter link description here you gain agree to more than 300 games betting, electronic betting clubs and different limits proposed to new and standard players! I, dependably's end, use and I'm sure that many will feel that it is basic!

1: https://crickexs.in/app/

Problem

Hello people! I genuinely need to direct you an exceptional application for Android and iOS in which you can bet, this connection enter link description here you gain agree to more than 300 games betting, electronic betting clubs and different limits proposed to new and standard players! I, dependably's end, use and I'm sure that many will feel that it is basic!

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21