Feb. 23, 2023, 9:12 a.m. by johnrusso555000
Biological Motivation
Blue Xanax Bars B707 are 2mg rectangular bars that belong to the benzodiazepine drug class. Breckenridge Pharmaceuticals manufactures and distributes this medication, which has the B707 imprint. It is a short-acting medication that treats anxiety, phobia (with or without), agoraphobia, fear, and panic disorder. Blue Xanax belongs to the Schedule IV controlled substance group (Controlled Substance Act). As previously stated, it belongs to the Triazolobenzodiazepine (TBZD) of medium duration family of medications. It is a benzodiazepine that inhibits abnormal brain activity and mediates and relaxes the body and central nervous system. Blue Xanax Bars is a 2mg Alprazolam pill that is dividable into bars. Use the appropriate dose first, consulting with your pharmacist. Then, take the drug exactly as prescribed by your doctor.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
