Suggested problems

Nước Dashi là gì? Gợi ý 6 công thức nấu nước Dashi đơn giản cho bé ăn dặm ngon hơn

Feb. 22, 2023, 2:26 p.m. by DINHNGHIA.com.vn - Bách Khoa Toàn Thư

Biological Motivation

Nước Dashi là một loại nước dùng được thay thế cho việc nêm nếm gia vị trong thức ăn dặm của trẻ em ở Nhật Bản. Hôm nay, hãy cùng Dinhnghia tìm hiểu xem nước Dashi là gì và những công thức nấu nước Dashi đơn giản tại nhà qua bài viết sau đây nhé! NGuồn (Source): https://www.dinhnghia.com.vn/nuoc-dashi-la-gi/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21