Suggested problems

Biological Motivation

Ksalol 1mg, a benzodiazepine drug, is an oral prescription medication used to treat and manage anxiety disorders, seizure disorders, generalized anxiety disorders, and phobias. It is one of the first-line treatments for a variety of health problems, including anxiety, seizures, GAD, and phobia with or without agoraphobia. If you Buy Ksalol 1mg Online, you can get immediate relief from any of these problems.

https://xanaxreviews.com/product/ksalol-1mg/

https://globalgraduates.com/questions/ksalol-1mg-overnight-delivery-xanax-reviews

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21