Suggested problems

Biological Motivation

Any immediate monetary needs lead to going for the money borrowing feature within the user's Cash App account. And, users choose short-term loans either for investments, medical emergencies, educational purposes, shopping needs, and money shortage recovery. So,

Here, they can borrow up to $20-$200 as per the user's eligibility. And, once the loan amount is passed for them, they can easily repay the amount in 4 weeks with a processing fee of 5% Moreover, they also get a repayment grace period with 1.25% charged every week.

So, you need not get stressed out, if you are not aware of [How To Borrow Money From Cash App][1]. You can easily visit the Cash App website or even initiate a customer care contact at any time and anywhere.

[1]: https://cashapphone.com/blog/how-to-borrow-money-from-cash-app

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21