Suggested problems

Buy Adderall Online Overnight With Shipped Instant

Feb. 20, 2023, 7:35 a.m. by drickjoe

Biological Motivation

Looking to buy Adderall online via PayPal? You've come to the right place! Reddit Pharmacy offers the best price on Adderall when you purchase through PayPal. Plus, we offer free shipping on all orders over $50. So what are you waiting for? Order your Adderall today and get it shipped directly to your door!

FOR ORDER:- https://redditpharmacy.com/product-category/buy-adderall-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21