Feb. 18, 2023, 6:52 a.m. by usmeds12
Biological Motivation
Klonopin is used to treat certain seizure disorders (such as absence seizures), as well as panic disorder and social anxiety disorder. In addition to its specific actions on GABA and glutamate, it also has residual effects on the cholinergic, adrenergic, dopaminergic, and muscarinic receptors. It is an intermediate-acting benzodiazepine drug that acts more quickly than typical benzodiazepines such as Valium or Xanax. It is available in several forms, including tablets, rectal suppositories, and transdermal patches.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
