Suggested problems

Biological Motivation

Adults with painful diabetic neuropathy, post-herpetic neuralgia, and other peripheral neuropathic pain conditions may benefit from Oxycodone treatment. For all indications, Table 1 describes a titration plan for the start of therapy, which is advised for teenagers and adults 12 years of age and older. Together with other drugs, Oxycodone is used to stop and manage seizures. Additionally, it helps people with nerve discomfort brought on by shingles. Anticonvulsant or antiepileptic drugs include Oxycodone.

https://legitpills.com/product-category/buy-oxycodone-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21