Suggested problems

Biological Motivation

Buy Adderall Online Overnight Adderall Online Overnight Adderall Online Buy Adderall Online legally Adderall Online Buy

https://rehabilative.com/product-category/buy-valium-online/ https://rehabilative.com/product-category/buy-valium-online/ https://rehabilative.com/product-category/buy-valium-online/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21