Suggested problems

Biological Motivation

Speaking from personal experience, I definitely know a very high quality cool app that almost every one of you can use now. And if you want to know where is this app builder and what will help you now, developing the coolest of them all, then basically there is only one option, namely go to this site https://flipabit.dev/ only here you can find the coolest builder for yourself. Position that you can definitely use with ease now, and it will be the best option for you. I can definitely tell you that.

Problem

I would like to mention that I myself often develop different applications and I can recommend you to go to this site https://flipabit.dev/ . Here you can definitely with ease find without you that cool application builder, which now almost every person is sure that you can use it without any problems, because this is exactly the best option for each of you. This is completely 100% true and I use it myself.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21