Biological Motivation

Canada cung cấp các lựa chọn định cư tuyệt vời trong một môi trường ổn định cho những ai muốn trở thành một phần của cảnh quan. Chính phủ Canada luôn chào đón những công dân nước ngoài đến sinh sống và làm việc. Để [định cư Canada][1] bạn cần biết 1 số lưu ý sau:

Tham khảo thêm: [https://aiic.vn/dinh-cu-canada-dien-tay-nghe/][2]

dinhcucanada #dinhcucanadadientaynghe #cachdinhcucanadadenhat #thexanhcanada #chiphidinhcucanada

ALLY - Đầu Tư và Định Cư Canada Add: Văn phòng 02, Tầng 08, Tòa nhà Pearl Plaza, 561A Điện Biên Phủ, P. 25, Q. Bình Thạnh, TP. HCM Phone: 02899989988

[1]: https://aiic.vn/dinh-cu-canada-dien-tay-nghe/ [2]: https://aiic.vn/dinh-cu-canada-dien-tay-nghe/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21