Suggested problems

Kienlongbank là ngân hàng gì? Thông tin chi tiết về ngân hàng Kienlongbank

Nov. 10, 2022, 2:21 p.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Kienlongbank là một trong những Ngân hàng thương mại cổ phần hoạt động ổn định và phát triển bền vững trong ngành ngân hàng tại Việt Nam. Nếu đang phân vân về các sản phẩm, dịch vụ của ngân hàng này, mời bạn cùng tìm hiểu rõ các thông tin liên quan đến Kienlongbank trong bài viết dưới đây! Nguồn kham khảo (Source): https://vanhoadoisong.vn/kienlongbank-la-ngan-hang-gi-thong-tin-chi-tiet-ve-ngan-hang-kienlongbank-1211/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21