Nov. 10, 2022, 8:37 a.m. by Pixenite
Biological Motivation
We are a team of experts for making brands buzz with all angles, since with a goal to integrate and satisfy all publicizing and marking prerequisites of our customers as per their craving. Pixenite serves you a 360 degree solution for your dream project as we strongly believe that your brand is more than your logo, name or trademark as it’s the wholesome experience of your Brand that you want to represent in front of your clients ..https://pixenite.com/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
