Suggested problems

40+ stt thả thính, cap thả thính kiểu dân chuyên văn

Nov. 9, 2022, 1:51 p.m. by VANHOADOISONG.vn - Thông tin Mẹ và bé tập luyện thể thao, thời

Biological Motivation

Thả thính như thế nào để “bách phát bách trúng”? Bài viết sẽ gửi đến bạn bí kíp thả thính qua 40+ stt thả thính, cap thả thính bằng văn học kiểu dân chuyên văn. Nắm lòng ngay để cưa đổ crush thôi nào! Tìm hiểu thêm (Source): https://vanhoadoisong.vn/40-stt-tha-thinh-cap-tha-thinh-kieu-dan-chuyen-van-942/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21