Nov. 9, 2022, 9:39 a.m. by ElizaMakode
Biological Motivation
[Pregabalin 50mg][1] Capsule (Pregabalin 50mg) is used to treat neuropathic pain, Epilepsy, anxiety, and Fibromyalgia. It is also used to treat certain types of seizures. Pregabalin 50mg is a medication used to treat neuropathic pain (pain caused by nerve injury) and fibromyalgia (severe muscle pain and tenderness). It is prescribed for diabetic nerve pain, epilepsy, spinal cord injury, restless leg syndrome, and generalized anxiety disorder. Pregabalin 50 (Pregabalin 50mg) is an anticonvulsant medication used to treat certain types of epilepsy in adults. It is believed to function by delaying nerve impulses in the brain that trigger seizures. It helps with symptoms like confusion, jerking movements that you can't stop, not being aware of what's going on, and fear or anxiety. What is Neuropathic pain? Neuropathic pain is caused by damage or injury to the nerves that carry information from the skin, muscles, and other body components to the brain and spinal cord. The pain is typically described as burning, stabbing, or shooting. The patient may describe the sensation as "pins and needles." Muscle discomfort is caused by tearing and stretching of the muscles or tendons. It is distinguished by symptoms such as muscle soreness, joint pain, and restricted motion.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
